AlchemyToday

So I had to come up with a new way to easily find out whether mutations that come up in cloning are something to worry about or not.  Here’s a Python script to do the job.  Paste in the intended sequence (in frame) and then a chunk of the mutated sequence either beginning or ending with the mutated base (enough of the sequence so that there’s a unique alignment) and figure out what the mutation was.  Dictionary specifying the genetic code courtesy someone else on a Python mailing list (lost the link) .  Easy to use:

python whatsthemutation.py

Original Sequence? ATGTTAAAACGTATCAAAATTGTGACCAGCTTACTGCTGGTTTTGGCCGTTTTTGGCCTT
Mutated region? CAATTGTGACCAGCTTACTG
AAA -> ACA
K -> T

After some investigation, it looks like CLC Sequence Viewer is the best program to use to access all of my old Vector NTI data without losing annotations and things.  Of course, there’s the problem that someone might try to charge for that in the future, but oh well.  There’s definitely demand from at least the handful of people I know using Vector NTI now for software that can import its data completely, has a database, and allows for simple construction and annotation of plasmids.  Primer design and integration with sequence alignment is nice, too, but not as neccessary.

I just noticed that I added this little box to the sidebar of the blog in early 2008:

HOT, CURRENTLY.

Trellises. Trading dollars for risky mortgages, so long as I’m not doing it. The rapidly approaching annual lapse in winter vegetables’ exclusive appeal.

Seems like it would’ve been smart to act on that hunch.  I also wanted to buy NVIDIA stock in early 2000 and I think it posted one of the biggest gains in the market over the next two years in the middle of the tech crash.  I think this goes to show, more than anything else, that it’s easy to see what will likely happen in the economy but impossible to predict when it will happen.