Archive for the 'Blinded with science' Category

People die of bedsores in the UK!

Sunday, July 5th, 2009

Of course the plural of anecdote isn’t really data, but that won’t stop Mark Steyn from spinning the tragic death of a cancer patient in the UK into an indictment of public health care:

When we quote stories like these at NRO, we get a lot of e-mail saying these are just “anecdotes”. And yes, if you look on yourself as being part of a government health system of millions of people, getting a bedsore and dying in hideous pain is no big deal in the scheme of things. But I look on myself as being part of the Mark Steyn health system. So if I get a bedsore and die, as far as I’m concerned, that’s a 100% systemic failure. The difference between government health care and a private system is that, under the latter, you’re free to say, “This dump’s filthy. I’m going to the state-of-the-art joint five miles up the road.” You may have to get out your checkbook, but ultimately the decisions are yours.

The problem is that there actually is data to look at here, gathered by the OECD.  And while I realize Steyn’s tongue is in his cheek, bedsores aren’t just a rare problem in the UK or in the United States.  Thousands of patients die in the United States each year from this almost entirely preventable problem.

Medical misadventures 2004

In fact, the rate of death from medical misadventures (including bedsores) is 40% higher in the United States than the UK.  It’s higher than every OECD country except Australia, Austria, Greece, and Iceland (I would guess that Italy, Portugal, and Turkey might also compete here, but they don’t have 2004 data).

Beyond that, the “Mark Steyn health system” exists in the UK, too, and out-of-pocket, uninsured costs are lower or the same than in the United States.  As a related example, the cost of removal of a breast lump is £1,200 – £2,000 in the UK ($2,000-$3300) and over $3,000 at one American hospital.

Mark’s also fascinated with maggot therapy:

That’s not a bug, it’s a… No, wait: It’s a bug and a feature! The maggot is apparently the leech of 21st century government health care. But, as with everything else, there weren’t enough of them.

Boy, that sounds scary!  As it turns out, this therapy was developed at Johns Hopkins, reintroduced by the VA, and is used in hundreds of American hospitals (not just unleashed on patients on the government dole, either).  A gross and awesome video of maggot therapy below the fold.

Read the rest of this entry »

Invitrogen started charging for Vector NTI…

Saturday, June 27th, 2009

So I had to come up with a new way to easily find out whether mutations that come up in cloning are something to worry about or not.  Here’s a Python script to do the job.  Paste in the intended sequence (in frame) and then a chunk of the mutated sequence either beginning or ending with the mutated base (enough of the sequence so that there’s a unique alignment) and figure out what the mutation was.  Dictionary specifying the genetic code courtesy someone else on a Python mailing list (lost the link) .  Easy to use:

python whatsthemutation.py

Original Sequence? ATGTTAAAACGTATCAAAATTGTGACCAGCTTACTGCTGGTTTTGGCCGTTTTTGGCCTT
Mutated region? CAATTGTGACCAGCTTACTG
AAA -> ACA
K -> T

After some investigation, it looks like CLC Sequence Viewer is the best program to use to access all of my old Vector NTI data without losing annotations and things.  Of course, there’s the problem that someone might try to charge for that in the future, but oh well.  There’s definitely demand from at least the handful of people I know using Vector NTI now for software that can import its data completely, has a database, and allows for simple construction and annotation of plasmids.  Primer design and integration with sequence alignment is nice, too, but not as neccessary.